circad | circRNAs associated with diseases

hsa_circ_0044235
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Rheumatoid Arthritis	ICD-10	Rheumatoid arthritis, unspecified (M06.9)
DBLink		PMID	30216431
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Patients and matched healthy controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGCACACAAACTCCCTGACA Reverse CACCTTCGAGGGAATAGCTG	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Luo, Q, Zhang, L, Li, X, Fu, B, Deng, Z, Qing, C, Su, R, Xu, J, Guo, Y, Huang, Z, Li, J (2018). Identification of circular RNAs hsa_circ_0044235 in peripheral blood as novel biomarkers for rheumatoid arthritis. Clin. Exp. Immunol., 194, 1:118-124.